Top » Catalog » G » A12506

$18.00

A12506
[A12506]

A12506
HG19 Position: ChrY:7792860..7792860
Ancestral: C
Derived: T
Reference: Rolf Langland (2016)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A12506_F CCCAGCTTGTTTAGGTGGTG
Reverse Primer: A12506_R TGGGCTTTGAGAACCATAAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies