Top » Catalog » G » A12508

$18.00

A12508
[A12508]

A12508
HG19 Position: ChrY:7016713..7016713
Ancestral: C
Derived: T
Reference: Rolf Langland (2016)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A12508_F GTCATGGGGCAAATGCTTAG
Reverse Primer: A12508_R AATTTCCTGGCATCGTTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies