Top » Catalog » G » A12509

$18.00

A12509
[A12509]

A12509
HG19 Position: ChrY:20377471..20377471
Ancestral: G
Derived: T
Reference: Rolf Langland (2016)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A12509_F TGCCCTGAAAAAGTCACCTC
Reverse Primer: A12509_R TAAATTCACCCCACCGAAAC
Reviews

Customers who bought this product also purchased
Z42616
Z42616
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies