Top » Catalog » G » FGC52608

$18.00

FGC52608
[FGC52608]

FGC52608
hg38 Position: ChrY:8373115..8373115
Ancestral: T
Derived: C
Reference: Full Genomes (2016)
ISOGG Haplogroup: G2a
Comments: .
Forward Primer: FGC52608_F GTCACCTAGGTTTTCACTTAGTGGTAG
Reverse Primer: FGC52608_R TCATATAATGGCCAGCAAACAG
Reviews

Customers who bought this product also purchased
FGC52664
FGC52664
FGC52618
FGC52618
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies