Top » Catalog » G » A13023

$18.00

A13023
[A13023]

A13023
hg38 Position: ChrY:14099752..14099752
Ancestral: G
Derived: T
Reference: Alain Verschaeren (2016)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A13023_F CAATGCATGCAACCAAAAAC
Reverse Primer: A13023_R AGGAAACAGAAGGGGCTTTG
Reviews

Customers who bought this product also purchased
A13025
A13025
A13024
A13024
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies