Top » Catalog » G » A13025

$18.00

A13025
[A13025]

A13025
hg38 Position: ChrY:21113943..21113943
Ancestral: A
Derived: G
Reference: Alain Verschaeren (2016)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A13025_F TTCATCCATTTTTCTGTTGATAGAC
Reverse Primer: A13025_R CACCTGGCAAGAGATCTGAG
Reviews

Customers who bought this product also purchased
A13024
A13024
A13023
A13023
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies