Top » Catalog » G » FGC295

$18.00

FGC295
[FGC295]

FGC295
hg38 Position: ChrY:7842818..7842818
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2a1a1c1a2b1a~
Comments: .
Forward Primer: FGC295_F TCTTCCCAGCATCAATGGTC
Reverse Primer: FGC295_R TAGCTCCTCCTTGTATGTCGC
Reviews

Customers who bought this product also purchased
Z3571
Z3571
FGC300
FGC300
Z3572
Z3572
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC34389
$18.00
Haplogroup Info
Other products
Currencies