Top » Catalog » G » M3422

$18.00

M3422
[M3422]

M3422
hg38 Position: ChrY:21103997..21103997
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: G2a2b1a2a
Comments: .
Forward Primer: M3422_F GGGACCAGAGAATAAGCCAAG
Reverse Primer: M3422_R TTATTCAAAAGCACAGCCTGATAC
Reviews

Customers who bought this product also purchased
HU1
HU1
PF3293
PF3293
G2a-L1259 Panel
G2a-L1259 Panel
L140
L140
M406
M406
U8
U8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies