Top » Catalog » G » F3547

$18.00

F3547
[F3547]

F3547
hg38 Position: ChrY:21636886..21636886
Ancestral: C
Derived: T
Reference: Yan Shi (2011)
ISOGG Haplogroup: G2a2a1a2a1a2~
Comments: Found in a hg J person. Likely a singleton.
Forward Primer: F3547_F TCCAAGAGGACAGGCTTCAG
Reverse Primer: F3547_R AGCCAATGCCTTTGACTTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY92093
1 x BY28089
$36.00
Haplogroup Info
Other products
Currencies