Top » Catalog » G » CTS7045

$18.00

CTS7045
[CTS7045]

CTS7045
hg38 Position: ChrY:15144745..15144745
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1c1a
Comments: Below Z1903
Forward Primer: CTS7045_F CCACCAAATAATAATTGAACTATTTAAGG
Reverse Primer: CTS7045_R ACACCCATGGATGACTTCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies