Top » Catalog » G » L830

$18.00

L830
[L830]

L830
hg38 Position: ChrY:6995867..6995867
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G1b
Comments: Found in a hg G-M285 WTY participant
Forward Primer: L830_F GAGACGGTGTTTCGCTCTTG
Reverse Primer: L830_R TCAATAGCAGGGTCCCAGAC
Reviews

Customers who bought this product also purchased
Z3353
Z3353
L497
L497
F4297
F4297
L1259
L1259
M201
M201
G Superclade Panel
G Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x GG206
1 x FGC5158
$36.00
Haplogroup Info
Other products
Currencies