Top » Catalog » G » F872

$18.00

F872
[F872]

F872
hg38 Position: ChrY:7064395..7064395
Ancestral: G
Derived: C
Reference: Yan Shi (2011)
ISOGG Haplogroup: G2a2b2b1a
Comments: Found in a hg G person. Likely a singleton.
Forward Primer: F872_F CACAACCCTTCAACCAGACCT
Reverse Primer: F872_R CATGCTGAAGTGGCTTCTCTATG
Reviews

Customers who bought this product also purchased
F1079
F1079
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies