Top » Catalog » G » FGC1146

$18.00

FGC1146
[FGC1146]

FGC1146
hg38 Position: ChrY:18994175..18994175
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G (not listed)
Comments: .
Forward Primer: FGC1146_F ACAATCCTCTGAGAACTCCCC
Reverse Primer: FGC1146_R CCAATAGACCAGGTTGGTGG
Reviews

Customers who bought this product also purchased
FGC1159
FGC1159
FGC1158
FGC1158
FGC1153
FGC1153
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies