Top » Catalog » G » FGC1153

$18.00

FGC1153
[FGC1153]

FGC1153
hg38 Position: ChrY:20636541..20636541
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G (not listed)
Comments: .
Forward Primer: FGC1153_F AATTGTATTCTCCCATATATGGCC
Reverse Primer: FGC1153_R TTCTATGTTCATGAGTGGTTAGGATC
Reviews

Customers who bought this product also purchased
FGC1158
FGC1158
FGC1146
FGC1146
FGC1159
FGC1159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies