Top » Catalog » G » FGC1159

$18.00

FGC1159
[FGC1159]

FGC1159
hg38 Position: ChrY:21323506..21323506
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a1a2
Comments: .
Forward Primer: FGC1159_F GAGTCTTGCCCTCTCACCG
Reverse Primer: FGC1159_R TTCTAGAAATATGTATTCAAGCTCACATC
Reviews

Customers who bought this product also purchased
FGC1158
FGC1158
FGC1153
FGC1153
FGC1146
FGC1146
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies