Top » Catalog » G » CTS12777

$18.00

CTS12777
[CTS12777]

CTS12777
hg38 Position: ChrY:26555352..26555352
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1a1a1b1
Comments: Below Z2017
Forward Primer: CTS12777_F AGAAGGCTGAGGCAAGAGG
Reverse Primer: CTS12777_R TTTGATTTATTGTTGATACAAGAATACAAC
Reviews

Customers who bought this product also purchased
Z42471
Z42471
Z6764
Z6764
Z29424
Z29424
Z2003
Z2003
Z42474
Z42474
Z30718
Z30718
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies