Top » Catalog » G » CTS12777

$18.00

CTS12777
[CTS12777]

CTS12777
hg38 Position: ChrY:26555352..26555352
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1a1a1b1
Comments: Below Z2017
Forward Primer: CTS12777_F AGAAGGCTGAGGCAAGAGG
Reverse Primer: CTS12777_R TTTGATTTATTGTTGATACAAGAATACAAC
Reviews

Customers who bought this product also purchased
Z2026
Z2026
Z3196
Z3196
U1
U1
G2a-L1259 Panel
G2a-L1259 Panel
Z2018
Z2018
Z42471
Z42471
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies