Top » Catalog » G » CTS2080

$18.00

CTS2080
[CTS2080]

CTS2080
hg38 Position: ChrY:12053108..12053108
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2a1a3d (not listed)
Comments: Below L91
Forward Primer: CTS2080_F GGACTGTTCTCCTAGTTCACGG
Reverse Primer: CTS2080_R CGCAAGAGAAAATGCCAGTTAG
Reviews

Customers who bought this product also purchased
FGC2315
FGC2315
L166
L166
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies