Top » Catalog » G » CTS2080

$18.00

CTS2080
[CTS2080]

CTS2080
hg38 Position: ChrY:12053108..12053108
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2a1a3d (not listed)
Comments: Below L91
Forward Primer: CTS2080_F GGACTGTTCTCCTAGTTCACGG
Reverse Primer: CTS2080_R CGCAAGAGAAAATGCCAGTTAG
Reviews

Customers who bought this product also purchased
Z42570
Z42570
FGC2315
FGC2315
L166
L166
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies