Top » Catalog » G » FGC32409

$18.00

FGC32409
[FGC32409]

FGC32409
hg38 Position: ChrY:13434045..13434045
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: G2b1b2
Comments: Approx or below FGC32413
Forward Primer: FGC32409_F CTCAAAAAGGAGACGCTGAG
Reverse Primer: FGC32409_R GAAGTCACATCACTGCATTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY21493
$18.00
Haplogroup Info
Other products
Currencies