Top » Catalog » G » FGC58189

$18.00

FGC58189
[FGC58189]

FGC58189
hg38 Position: ChrY:20956642..20956642
Ancestral: C
Derived: T
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: G2a2a1a1a~
Comments: Below M286.
Forward Primer: FGC58189_F AGACCCTTGCCTGTCTTCAC
Reverse Primer: FGC58189_R TGTCCCTCCCCACATAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC767
1 x GG002
1 x FGC7283
1 x CTS826
$72.00
Haplogroup Info
Other products
Currencies