Top » Catalog » G » A17583

$18.00

A17583
[A17583]

A17583
hg38 Position: ChrY:7711632..7711632
Ancestral: C
Derived: A
Reference: Igor Schein (2017)
ISOGG Haplogroup: G2a2b2a1a1c1a1b1a1a2a1
Comments:
Forward Primer: A17583_F CAAATAGCTTCTCCCTTGTGTG
Reverse Primer: A17583_R TGAGACATTTTATTCCAAGGGATG
Reviews

Customers who bought this product also purchased
Z44694
Z44694
Z44695
Z44695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies