Top » Catalog » G » CTS3647

$18.00

CTS3647
[CTS3647]

CTS3647
hg38 Position: ChrY:12982191..12982191
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3647_F TTGACCACCAAATAATTAACGAAC
Reverse Primer: CTS3647_R TGGCTACAATTTGTGTGTTTAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies