Top » Catalog » G » HU475

$18.00

HU475
[HU475]

HU475
hg38 Position: ChrY:13224513..13224513
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: G2a (not listed)
Comments: Below L14 > Z17084
Forward Primer: HU475_F CAAGAAACCACTGACAAAATGG
Reverse Primer: HU475_R CCTCCACCTCCTGGATTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1006
1 x FGC251
1 x M3413
$54.00
Haplogroup Info
Other products
Currencies