Top » Catalog » G » CTS7357

$18.00

CTS7357
[CTS7357]

CTS7357
hg38 Position: ChrY:15325344..15325344
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1a1a3
Comments: Syn. with CTS2526; downstream PAGES00093
Forward Primer: CTS7357_F GTGGTTTCCTGAGTCTAGAAATAGGA
Reverse Primer: CTS7357_R CAAATATATTTGAGCAATCTGCTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies