Top » Catalog » G » FGC7337

$18.00

FGC7337
[FGC7337]

FGC7337
hg38 Position: ChrY:17427650..17427650
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2b1a (not listed)
Comments: Found in the Van Beurden sample
Forward Primer: FGC7337_F ATTCCAAAGTGGTGCCAATG
Reverse Primer: FGC7337_R ATGGACACAGAAACGGGAAC
Reviews

Customers who bought this product also purchased
FGC7262
FGC7262
FGC7286
FGC7286
FGC7345
FGC7345
FGC7305
FGC7305
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x M3191
$18.00
Haplogroup Info
Other products
Currencies