Top » Catalog » G » FGC66784

$18.00

FGC66784
[FGC66784]

FGC66784
hg38 Position: ChrY:8300791..8300791
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC66784_F TTCTTCTTGAGTCGGTTTGG
Reverse Primer: FGC66784_R TTGGACTCCTGCTAAAAGTTAGTG
Reviews

Customers who bought this product also purchased
FGC66783
FGC66783
FGC66800
FGC66800
FGC66798
FGC66798
FGC66797
FGC66797
FGC66793
FGC66793
FGC66803
FGC66803
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY95730
1 x BY48320
$36.00
Haplogroup Info
Other products
Currencies