Top » Catalog » G » FGC66798

$18.00

FGC66798
[FGC66798]

FGC66798
hg38 Position: ChrY:19650023..19650023
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC66798_F GCCCAAATCAACTGGATAGC
Reverse Primer: FGC66798_R ACCCAGAGGTGCAAGTCAAG
Reviews

Customers who bought this product also purchased
FGC66793
FGC66793
FGC66792
FGC66792
FGC66803
FGC66803
FGC66784
FGC66784
FGC66802
FGC66802
FGC66783
FGC66783
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies