Top » Catalog » G » FGC66802

$18.00

FGC66802
[FGC66802]

FGC66802
hg38 Position: ChrY:20527199..20527199
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC66802_F TTCCCCTGTGGATAAAGCAG
Reverse Primer: FGC66802_R TATCATGCCTCAGCCTCCTG
Reviews

Customers who bought this product also purchased
FGC66793
FGC66793
FGC66792
FGC66792
FGC66803
FGC66803
FGC66784
FGC66784
FGC66800
FGC66800
FGC66783
FGC66783
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L1326
$18.00
Haplogroup Info
Other products
Currencies