Top » Catalog » G » FGC52645

$18.00

FGC52645
[FGC52645]

FGC52645
hg38 Position: ChrY:17084599..17084599
Ancestral: A
Derived: T
Reference: Full Genomes (2016)
ISOGG Haplogroup: G2a
Comments:
Forward Primer: FGC52645_F TGCTATGCCCAACATATTTCC
Reverse Primer: FGC52645_R CTGCATAGGGAAGGAGCAAG
Reviews

Customers who bought this product also purchased
FGC52660
FGC52660
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x GG059
1 x F3536
$36.00
Haplogroup Info
Other products
Currencies