Top » Catalog » G » FGC52660

$18.00

FGC52660
[FGC52660]

FGC52660
hg38 Position: ChrY:20574916..20574916
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC52660_F CATCAATCCTCGAATGTGTCC
Reverse Primer: FGC52660_R TAGCACCCAGCGGAATACTG
Reviews

Customers who bought this product also purchased
FGC52645
FGC52645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1551
1 x M3311
1 x FGC764
1 x GG239
$72.00
Haplogroup Info
Other products
Currencies