Top » Catalog » G » A199

$18.00

A199
[A199]

A199
hg38 Position: ChrY:8394067..8394067
Ancestral: G
Derived: A
Reference: Ray Banks (2014)
ISOGG Haplogroup: G2a1a1a1a1a1b1a
Comments: Below Z7947.
Forward Primer: A199_F TCAGACAGGACACATCTTGTTATG
Reverse Primer: A199_R TTGGGATTCCACCTGTCATAG
Reviews

Customers who bought this product also purchased
A205
A205
B375
B375
Z7949
Z7949
FGC716
FGC716
A201
A201
A200
A200
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies