Top » Catalog » G » CTS718

$18.00

CTS718
[CTS718]

CTS718
hg38 Position: ChrY:7105177..7105177
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1a6~
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS718_F TGCCACGAGCTATGATTGTC
Reverse Primer: CTS718_R TTCCATCTTGCCTCACATTG
Reviews

Customers who bought this product also purchased
CTS10324
CTS10324
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies