Top » Catalog » G » A20535

$18.00

A20535
[A20535]

A20535
hg38 Position: ChrY:21222237..21222237
Ancestral: A
Derived: C
Reference: Whit Athey (2018)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A20535_F CCTGCAAGTGGATGGATCTC
Reverse Primer: A20535_R CCCAGCAATACAGAGTTTTGG
Reviews

Customers who bought this product also purchased
FGC72373
FGC72373
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies