Top » Catalog » G » A200

$18.00

A200
[A200]

A200
hg38 Position: ChrY:12960928..12960928
Ancestral: T
Derived: C
Reference: Ray Banks (2014)
ISOGG Haplogroup: G2a1a1a1a1a1b1a1~
Comments: Approx. G-Z7947
Forward Primer: A200_F CGGGGGTCCTCTGTCTATTAC
Reverse Primer: A200_R GATCAGTGCCCTGGTTACATC
Reviews

Customers who bought this product also purchased
A205
A205
FGC686
FGC686
A201
A201
A199
A199
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies