Top » Catalog » G » A205

$18.00

A205
[A205]

A205
hg38 Position: ChrY:21383519..21383519
Ancestral: G
Derived: T
Reference: Ray Banks (2014)
ISOGG Haplogroup: G2a1a1a1a1a1b1a1~
Comments: Approx. G-Z7947
Forward Primer: A205v2_F GGATATACTTACACAGACGTGGAGC
Reverse Primer: A205v2_R CCTGTCCTCATTGCTCTCTCC
Reviews

Customers who bought this product also purchased
A201
A201
A200
A200
A199
A199
FGC702
FGC702
B375
B375
FGC772
FGC772
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies