Top » Catalog » G » FGC679

$18.00

FGC679
[FGC679]

FGC679
hg38 Position: ChrY:7968084..7968084
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a1a1a1a1b1
Comments: Approx. G-Z7947
Forward Primer: FGC679_F TAACTGGGTGCTGGAACAGG
Reverse Primer: FGC679_R TGAGCCCAACATTAACATCG
Reviews

Customers who bought this product also purchased
Z16578
Z16578
Z16573
Z16573
Z16577
Z16577
FGC681
FGC681
Z16576
Z16576
FGC756
FGC756
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC58731
$18.00
Haplogroup Info
Other products
Currencies