Top » Catalog » G » FGC758

$18.00

FGC758
[FGC758]

FGC758
hg38 Position: ChrY:19809697..19809697
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a1a1a1a1b1
Comments: Approx. G-Z7947
Forward Primer: FGC758_F TGCCTCCTTGGCTAGTCATG
Reverse Primer: FGC758_R TCTCTAATTCATAGTACCTCCTGCTC
Reviews

Customers who bought this product also purchased
Z16572
Z16572
Z16578
Z16578
Z16573
Z16573
Z16577
Z16577
FGC681
FGC681
Z16576
Z16576
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC58189
1 x A19505
1 x BY27998
1 x M3471
1 x F1218
1 x GG047
1 x L297
1 x BY121828
1 x CTS1879
$162.00
Haplogroup Info
Other products
Currencies