Top » Catalog » G » FGC772

$18.00

FGC772
[FGC772]

FGC772
hg38 Position: ChrY:21083895..21083895
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a1a1a1a1b1
Comments: Approx. G-Z7947
Forward Primer: FGC772_F GATCTCTCCCTAAACACCTAGGC
Reverse Primer: FGC772_R GAACCCATGCAGAAGAGTCAC
Reviews

Customers who bought this product also purchased
FGC681
FGC681
Z16576
Z16576
FGC756
FGC756
Z16574
Z16574
Z16572
Z16572
Z16578
Z16578
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC767
1 x GG002
1 x FGC7283
1 x CTS826
$72.00
Haplogroup Info
Other products
Currencies