Top » Catalog » G » A21080

$18.00

A21080
[A21080]

A21080
hg38 Position: ChrY:12167989..12167989
Ancestral: G
Derived: A
Reference: Whit Athey (2018)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A21080_F TCTCTGGATTAAAAACAACCTAATC
Reverse Primer: A21080_R ATCGACCCCTTGTTTTAGGG
Reviews

Customers who bought this product also purchased
FGC41973
FGC41973
A21081
A21081
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies