Top » Catalog » G » A21080

$18.00

A21080
[A21080]

A21080
hg38 Position: ChrY:12167989..12167989
Ancestral: G
Derived: A
Reference: Whit Athey (2018)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A21080_F TCTCTGGATTAAAAACAACCTAATC
Reverse Primer: A21080_R ATCGACCCCTTGTTTTAGGG
Reviews

Customers who bought this product also purchased
Z46067
Z46067
FGC41973
FGC41973
A21081
A21081
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies