Top » Catalog » G » A21081

$18.00

A21081
[A21081]

A21081
hg38 Position: ChrY:17299544..17299544
Ancestral: T
Derived: C
Reference: Whit Athey (2018)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A21081_F TGCATTGCGAATTGTATTAAGC
Reverse Primer: A21081_R GTCAGCAGCAGTTGACCAAG
Reviews

Customers who bought this product also purchased
A21080
A21080
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC58189
1 x A19505
1 x BY27998
1 x M3471
1 x F1218
1 x GG047
1 x L297
$126.00
Haplogroup Info
Other products
Currencies