Top » Catalog » G » FGC1107

$18.00

FGC1107
[FGC1107]

FGC1107
hg38 Position: ChrY:7125708..7125708
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a1a2a1
Comments: .
Forward Primer: FGC1107_F GAACAATCCCTGGGGTCTG
Reverse Primer: FGC1107_R GGATAAAATCAATGTCGGTCAGTC
Reviews

Customers who bought this product also purchased
Z6673
Z6673
Wish a SNP
Wish a SNP
FGC1124
FGC1124
FGC1110
FGC1110
FGC1106
FGC1106
FGC1121
FGC1121
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x M3562
1 x GG060
1 x CTS293
1 x GG173
$72.00
Haplogroup Info
Other products
Currencies