Top » Catalog » G » CTS4803

$18.00

CTS4803
[CTS4803]

CTS4803
hg38 Position: ChrY:13721300..13721300
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1a2a
Comments: Syn. with CTS4803; downstream CTS11352
Forward Primer: CTS4803_F GTTGGGGAGGGAAGTAGAGG
Reverse Primer: CTS4803_R CAGACTGCAAGGCTGTGTTC
Reviews

Customers who bought this product also purchased
Z41649
Z41649
Z16777
Z16777
Z1823
Z1823
FGC60019
FGC60019
Z42514
Z42514
L497
L497
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies