Top » Catalog » G » CTS4803

$18.00

CTS4803
[CTS4803]

CTS4803
hg38 Position: ChrY:13721300..13721300
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1a2a
Comments: Syn. with CTS4803; downstream CTS11352
Forward Primer: CTS4803_F GTTGGGGAGGGAAGTAGAGG
Reverse Primer: CTS4803_R CAGACTGCAAGGCTGTGTTC
Reviews

Customers who bought this product also purchased
Z34079
Z34079
Z16770
Z16770
Z725
Z725
G2a-L497 Panel
G2a-L497 Panel
Z31321
Z31321
Z6150
Z6150
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies