Top » Catalog » G » CTS4803

$18.00

CTS4803
[CTS4803]

CTS4803
hg38 Position: ChrY:13721300..13721300
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1a2a
Comments: Syn. with CTS4803; downstream CTS11352
Forward Primer: CTS4803_F GTTGGGGAGGGAAGTAGAGG
Reverse Primer: CTS4803_R CAGACTGCAAGGCTGTGTTC
Reviews

Customers who bought this product also purchased
Z16770
Z16770
Z725
Z725
Z34079
Z34079
F720
F720
S2808
S2808
Z726
Z726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies