Top » Catalog » G » FGC7358

$18.00

FGC7358
[FGC7358]

FGC7358
hg38 Position: ChrY:21075127..21075127
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2b1a (not listed)
Comments: Found in the Van Beurden sample
Forward Primer: FGC7358_F TTGTGACTCAGCCACCTCAG
Reverse Primer: FGC7358_R TCTTCTTTGGGGACAGAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies