Top » Catalog » G » CTS4304

$18.00

CTS4304
[CTS4304]

CTS4304
hg38 Position: ChrY:13447923..13447923
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b1b1e~
Comments: Approx. M406
Forward Primer: CTS4304_F TGATTCACAAGCGAAAGTGG
Reverse Primer: CTS4304_R AGACAGCAAGTGTTGGCTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies