Top » Catalog » G » CTS730

$18.00

CTS730
[CTS730]

CTS730
hg38 Position: ChrY:7111099..7111099
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1
Comments: Equiv. to Z1815. below L497
Forward Primer: CTS730_F ATGCCTGAGACAGTTCCAGC
Reverse Primer: CTS730_R CTAATAGCTTGCACCCTGTGG
Reviews

Customers who bought this product also purchased
Z31357
Z31357
L42
L42
S10458
S10458
S2808
S2808
Z726
Z726
Z725
Z725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies