Top » Catalog » G » CTS730

$18.00

CTS730
[CTS730]

CTS730
hg38 Position: ChrY:7111099..7111099
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1
Comments: Equiv. to Z1815. below L497
Forward Primer: CTS730_F ATGCCTGAGACAGTTCCAGC
Reverse Primer: CTS730_R CTAATAGCTTGCACCCTGTGG
Reviews

Customers who bought this product also purchased
Z31357
Z31357
L42
L42
Z726
Z726
Z725
Z725
Z27264
Z27264
G2a-L497 Panel
G2a-L497 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies