Top » Catalog » G » FGC8304

$18.00

FGC8304
[FGC8304]

FGC8304
hg38 Position: ChrY:2916543..2916543
Ancestral: T
Derived: A
Reference: Full Genomes Inc (2014)
ISOGG Haplogroup: G2a2b2a1b1a2a (not listed)
Comments: Below G-CTS4803 and. also further down below G-S2808
Forward Primer: FGC8304_F GCATTGCAGAGGAGCTTTTTAG
Reverse Primer: FGC8304_R CCTGGCTGTCTCGGTATTG
Reviews

Customers who bought this product also purchased
FGC8303
FGC8303
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x GG190
$18.00
Haplogroup Info
Other products
Currencies