Top » Catalog » G » FGC52622

$18.00

FGC52622
[FGC52622]

FGC52622
hg38 Position: ChrY:13085753..13085753
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC52622_F AATCTCTATAATCTTCATTTGGTGTATTTC
Reverse Primer: FGC52622_R AAGGCCTAATGTAAGTGAAAAGCTTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L1342
$18.00
Haplogroup Info
Other products
Currencies