Top » Catalog » I1 » A6613

$19.00

A6613
[A6613]

A6613
hg38 Position: ChrY:7189638..7189638
Ancestral: G
Derived: A
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2b
Comments: Downstream Z138+
Forward Primer: A6613_F CCGCACTAAGAAGAACTGGAAGT
Reverse Primer: A6613_R AAATACAGACCCTTTTAGTAACTGTTTTTC
Reviews

Customers who bought this product also purchased
Y190848
Y190848
A8412
A8412
Y16452
Y16452
S9940
S9940
Z63
Z63
FGC4433
FGC4433
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies