Top » Catalog » I1 » A6613

$18.00

A6613
[A6613]

A6613
hg38 Position: ChrY:7189638..7189638
Ancestral: G
Derived: A
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2b
Comments: Downstream Z138+
Forward Primer: A6613_F CCGCACTAAGAAGAACTGGAAGT
Reverse Primer: A6613_R AAATACAGACCCTTTTAGTAACTGTTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1656
$18.00
Haplogroup Info
Other products
Currencies