Top » Catalog » I1 » A397

$18.00

A397
[A397]

A397
hg38 Position: ChrY:8286322..8286322
Ancestral: C
Derived: T
Reference: John M. Rhodes (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A397_F TGCAGCCTCTATCTCCCAAG
Reverse Primer: A397_R GGTTTTCCTTCCCACTTCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies